Chromosome Conformation Capture (3C): DLO Hi-C

Overview

This protocol describes a chromosome conformation capture (3C) sequencing method based on Lin et al. (2018). In this approach, the authors developed a simplified digestion-ligation-only Hi-C (DLO-HiC) protocol to explore the 3D organization of the genome. Unlike conventional Hi-C methods, DLO-HiC does not require biotin labeling or pull-down steps and involves only two rounds of digestion and ligation. I have made some minor adjustments to ensure the protocol is suitable for both leaf tissue and whole-body insects.

Mechanism overview

1. Restriction digestion → Genome is cut by your chosen enzyme (e.g., HindIII → 5’-A|AGCTT-3’).
   
2. First ligation → Each DNA end gets ligated to a half-linker with a compatible sticky end (e.g., “AGCT”).
   
3. Second ligation → Two half-linkers (one on each fragment end) are ligated together, joining the two genomic fragments.
   
4. MmeI digestion → MmeI cuts 20 bp away from its site, trimming the junction and leaving a defined short sequence ready for PCR and sequencing.

After MmeI digestion, the final sequenced molecule looks like:

[Adaptor]–[20 bp genomic fragment 1]–[Linker barcode]–[20 bp genomic fragment 2]–[Adaptor]

1. Cell Preparation and Restriction Enzyme Digestion

Prepare prior:

double cross-linking buffer: 1.5 mM EGS and 1% formaldehyde

1. 1. Homogenize tissue with liquid nitrogen.

   • Insect: 50 - 200 mg

   • Plant: 200 mg - 1 g leaf or seed tissue, avoid stem or woody plant tissue. Use younger plant tissue, as it tends to yield higher DNA yields and higher-quality libraries.

2. Pellet suspended cells by centrifugation at **1,000 rpm for 5 min** and wash once with **ice-cold PBS**. (not sure if necessary if we homogenize with liquid nitrogen

3. to pellet add ~1 mL **double cross-linking** buffer containing:

   • 1.5 mM EGS

   • 1% formaldehyde

4. Quench cross-linking with ~125 μL **glycine**

   • concentration should ~0.125 M

5. Lyse cells in lysis buffer containing

   • 10 mM Tris-HCl pH 8.0
   • 10 mM NaCl
   • 0.3% Igepal CA-630,
   • Complete protease inhibitors

6. Resuspend nuclei in 100 μL of 1% SDS, incubate at 60 °C for 5 min, then place on ice.
   

7. Split nuclei into two 1.5-mL tubes (Tube A and Tube B).
   

8. To each tube, add:

   • 50 μL 20% Triton X-100
     
   • 15 μL HindIII (100 U/μL)
     
   • 385 μL 1.3× NEBuffer 2.1
     

9. Incubate for 6 h at 37 °C with rotation at 15 rpm.

---

2. MmeI Half-Linker Ligation

1. For each tube (500 ul) of digested chromatin (Tube A and Tube B), add:

• 50 μL of 10× NEBuffer 2.1.
• 200 μL of the appropriate half-linker (600 ng/μL).
• 10 μL of 100 mM ATP.
• 10 μL of HindIII (100 U/μL).
• 5 μL of T7 DNA ligase (3,000 U/μL).
• 225 μL of ddH₂O.

2. Mix thoroughly and incubate 1 h at 25 °C with rotation at 15 rpm.

---

3. Purification of Linker-Ligated Chromatin DNA–Protein Complex

1. Centrifuge at 17,000 rpm for 1 h at 4 °C.
   
2. Discard the supernatant.
   
3. Resuspend pellet in 1 mL PBS, centrifuge again (17,000 rpm for 1 h at 4 °C).
   
4. Discard the supernatant.

---

4. In-Gel Ligation

1. Dissolve pellets from Tubes A and B in 50 μL of 1% SDS, then combine into one tube.
   
2. Add 10 mL of prewarmed (37 °C) 1× T4 DNA ligation buffer containing:
   • 0.4% low-melting-point agarose
     
   • 1% Triton X-100
     
   • 400 U T4 DNA ligase
     
3. Mix well and quickly solidify the gel in ice water.
   
4. Perform in-gel ligation at 20 °C for 6 h.

---

5. Reversal of Cross-Linking and DNA Purification

1. Melt agarose gel and digest with 20 μL β-agarase at 65 °C for 1 h.
   
2. Transfer digested product to Amicon Ultra-15 (30 kDa) filters, centrifuge at 5,000 rpm, and wash twice with ddH₂O.
   
3. Concentrate to 800 μL.
   
4. Add:
   • 100 μL 10% SDS
     
   • 100 μL Proteinase K (10 mg/mL)
     
5. Incubate 3 h at 60 °C to release DNA.
   
6. Extract twice with phenol:chloroform:isoamyl alcohol (25:24:1).
   
7. Centrifuge 15 min at 14,000 rpm, transferring supernatant each time.
   
8. Precipitate DNA using:
   • 10 μL Dr. GenTLE Precipitation Carrier
     
   • 100 μL 3 M sodium acetate (pH 5.2)
     
   • Equal volume isopropanol
     
9. Wash with 80% ethanol and dissolve in 160 μL ddH₂O.
   
10. Measure DNA concentration with a NanoDrop-1000.

---

6. MmeI Digestion and Purification of 80-bp DLO Hi-C DNA Fragments

1. To 160 μL DNA, add:
   • 20 μL 10× CutSmart buffer
     
   • 10 μL SAM (NEB)
     
   • 10 μL MmeI (2 U/μL)
     
2. Incubate 1 h at 37 °C.
   
3. Run the digested sample on native PAGE, excise 80-bp fragments.
   
4. Transfer gel slices to a 0.6-mL tube (pierced bottom) nested inside a 1.5-mL tube.
   
5. Centrifuge 14,000 rpm for 10 min to shred gel.
   
6. Add 400 μL TE buffer and incubate:
   • 20 min at –80 °C
     
   • 2 h at 37 °C with rotation (15 rpm)
     
7. Transfer mixture to Spin-X tube filter and centrifuge.
   
8. To eluate, add:
   • 4 μL Dr. GenTLE Carrier or another DNA carrier
     
   • 40 μL 3 M sodium acetate (pH 5.2)
     
   • Equal volume isopropanol
     
9. Precipitate DNA, wash with 80% ethanol, and dissolve in 40 μL ddH₂O.

---

7. Illumina sequencing library construction

Adapter Ligation

Reagents and volumes (per reaction): | Reagent | Concentration | Volume (µL) | |—————————-|———————-|—————–| | DLO Hi-C DNA fragments | — | 40 | | PE-adapter 1 | 500 ng/µL | 1.5 | | PE-adapter 2 | 500 ng/µL | 1.5 | | 10× T4 DNA Ligase Buffer | 10× | 5 | | T4 DNA Ligase (Thermo) | 2 U/µL | 2 | | Total Volume | — | 50 |

1. Combine the reagents listed above in a sterile microcentrifuge tube.
2. Mix gently by pipetting or flicking the tube.
3. Incubate the reaction at 16 °C for 30 min.

Adapter Cleanup

1. Add 90 µL (1.8x) AMPure XP beads to the ligation reaction.
2. Mix thoroughly and incubate at room temperature for 5 min.
3. Place the tube on a magnetic rack and discard the supernatant.
4. Wash the beads twice with 80% ethanol.
5. Air-dry the beads briefly (avoid over-drying).
6. Elute DNA from the beads with 45 µL ddH₂O.

DNA Repair

1. Combine eluted DNA with PreCR Repair Mix for a total volume of 50 µL.
2. Incubate at 37 °C for 20 min.

PCR Amplification

1. Set up PCR using 5–10 µL repaired DNA as the template and PCR Master Mix per manufacturer’s protocol.
2. Amplify for fewer than 13 cycles.
3. Verify library size and quality by agarose gel or Bioanalyzer.

---

✅ Protocol Complete — DLO Hi-C Library Ready for Sequencing

---

Reagents and Materials

Cross-Linking

• PBS (ice-cold)
  
• EGS (ethylene glycol bis(succinimidyl succinate); Thermo)
  
• Formaldehyde (1%; Sigma)
  
• Glycine

---

Lysis and Digestion

• Tris-HCl (10 mM, pH 8.0)
  
• NaCl (10 mM)
  
• Igepal CA-630 (0.3%)
  
• Complete protease inhibitor cocktail (Roche)
  
• SDS (1%)
  
• Triton X-100 (20%)
  
• HindIII (NEB, 100 U/μL)
  
• NEBuffer 2.1 (NEB)

---

Linker Ligation

• Annealed Half-linker A and B oligos (600 ng/μL) (see notes for annealing protocol)
• ATP (100 mM)
  
• T7 DNA ligase (NEB, 3,000 U/μL)
  
• ddH₂O

Half-Linker Set 1 (HindIII)

Half-Linker	Top Strand	Bottom Strand	Annealed Product
Half-Linker A	5’-p-GATAGCTCAAGAACTCCGAC-3’	5’-p-AGCTGTCGGAGTTCTTTGAGCTATC-3’	dsDNA Half-Linker A
Half-Linker B	5’-p-CTTAGCTCAAGAACTCCGAC-3’	5’-p-AGCTGTCGGAGTTCTTTGAGCTAAG-3’	dsDNA Half-Linker B

Half-Linker Set 2 (HindIII)

Half-Linker	Top Strand	Bottom Strand	Annealed Product
Half-Linker A	5’-p-GATCGCTCAAGAACTCCGAC-3’	5’-p-AGCTGTCGGAGTTCTTTGAGCGATC-3’	dsDNA Half-Linker A
Half-Linker B	5’-p-CTTACCTCAAGAACTCCGAC-3’	5’-p-AGCTGTCGGAGTTCTTTGAGGTAAG-3’	dsDNA Half-Linker B

---

In-Gel Ligation

• T4 DNA ligation buffer (1×; Thermo)
  
• Low-melting-point agarose (0.4%; Takara)
  
• T4 DNA ligase (400 U; Thermo)

---

Cross-Link Reversal and DNA Purification

• β-Agarase (Takara)
  
• Amicon Ultra-15 filters (30 kDa; Millipore)
  
• Proteinase K (10 mg/mL; Sigma)
  
• SDS (10%)
  
• Phenol:chloroform:isoamyl alcohol (25:24:1)
  
• Sodium acetate (3 M, pH 5.2)
  
• Isopropanol
  
• Ethanol (80%)
  
• ddH₂O
  
• NanoDrop-1000 spectrophotometer (Thermo)

---

MmeI Digestion and DNA Recovery

• CutSmart buffer (10×; NEB)
  
• S-Adenosylmethionine (SAM; NEB)
  
• MmeI (2 U/μL; NEB)
  
• TE buffer
  
• Spin-X tube filters (Costar 8160)

---

Illumina Library Construction

Adapter ligation

• 10× T4 DNA Ligase Buffer
• T4 DNA Ligase (Thermo; 2 U/µL)
• PE-adapter 1 (500 ng/µL)
• PE-adapter 2 (500 ng/µL)

PE-adapter 1 5’-OH–ACACTCTTTCCCTACACGACGCTCTTCCGATCTNN–OH-3’ 3’-OH–TGTGAGAAAGGGATGTGCGAGAAGGCTAGA–OH-5’

PE-adapter 2 5’-OH–GATCGGAAGAGCACACGTCTGAACTCCAGTCAC–OH-3’ 3’-OH–NNCTAGCCTTCTCGTGTGCTCTTCCGATCAGTG–OH-5’

Adapter Cleanup

• AMPure XP beads
• 80% ethanol
• Nuclease-free water (ddH₂O)

DNA Repair

• PreCR Repair Mix (NEB): per manufacturer’s instructions

PCR Amplification

• Repaired DNA: 5–10 µL (template)
• PCR master mix: per manufacturer’s protocol
• PCR Primers

PCR Primer 1	5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’
PCR Primer 2	5’-CAAGCAGAAGACGGCATACGAGAT(index)GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-3’

---

Notes

Generation of MmeI Half-Linkers To phosphorylate and anneal paired oligonucleotides to generate MmeI half-linkers. This have to be done separately for each half linker.

Reagents:
- Paired oligonucleotides (top and bottom) - T4 Polynucleotide Kinase (T4 PNK; NEB)
- 10× T4 PNK Buffer (NEB)
- ATP (as required by buffer formulation)

Procedure:
1. Mix paired oligonucleotides with T4 PNK and 10× PNK buffer according to manufacturer’s instructions.
2. Incubate the reaction at 37 °C for 30 min to phosphorylate the oligos.
3. Place the reaction in a thermocycler and anneal using the following program:
- 95 °C for 5 min
- Gradual cooling to 25 °C at a rate of 5 °C per minute
4. Store annealed half-linkers at –20 °C until use.

post image credit: © majcot - stock.adobe.com